Endometrial cancer gene database Home
Endometrial cancer database
Gene information | Literature | T1/T2 Diff | Expression | lncRNA | Regulation | Mutation | Homolog | Interaction

Basic Information

Gene ID

442893

Name

MIR151A

Synonym

MIR151|MIRN151|hsa-mir-151|hsa-mir-151a;microRNA 151a;MIR151A;microRNA 151a

Definition

microRNA 151

Position

-

Gene Type

ncRNA

External Links

Links to Entrez Gene

442893

Links to WikiGenes

442893

Links to tumor suppressors

442893

Links to dbEMT

442893

Links to iHOP

442893

Sequence Information

Nucleotide Sequence

>442893 : length: 90
TTTCCTGCCCTCGAGGAGCTCACAGTCTAGTATGTCTCATCCCCTACTAGACTGAAGCTC
CTTGAGGACAGGGATGGTCATACTCACCTC

Protein Sequence

>442893 : length: 3
N/A